100. Global warming has made the Caribbean islands too hot for tourists to continue to visit
a. correct
b. incorrect

Answers

Answer 1
the answer would be -> b. incorrect

Related Questions

What are the standards of living in Indonesia?

Answers

Explanation:

Indonesia has an unusually high life expectancy rate of 71 years. This number was much lower in the past but thanks to government-funded health programs for the poor, 111.6 million people now have access to health care

What determines where a temperate deciduous forest can exist? (Select all that apply.)
migration patterns of animals
the winds from the ocean
precipitation
seasonal temperature changes

Answers

Answer:I think winds is one

Explanation:

i don’t know

Answer:

The winds from the ocean and seasonal temperature

Explanation:

they include things from the forest!

In North Florida, there are concerns that groundwater withdrawals to meet regional water use demands are negatively affecting the volume of water available for natural spring systems, considered a unique and significant regional environmental resource. This complex situation creates a significant ethical dilemma. Common ethical theories were discussed in the textbook readings and outlined in the lectures. Select the pair of theories that would best apply to this ethical dilemma: Group of answer choices

Answers

This question is incomplete because the options are missing, here is the complete question:

In North Florida, there are concerns that groundwater withdrawals to meet regional water use demands are negatively affecting the volume of water available for natural spring systems, considered a unique and significant regional environmental resource. This complex situation creates a significant ethical dilemma. Common ethical theories were discussed in the textbook readings and outlined in the lectures. Select the pair of theories that would best apply to this ethical dilemma:

Utilitarianism approach and common good approach

Utilitarianism approach and rights approach

Fairness/justice approach and virtue approach

Rights approach and virtue approach

The correct answer is the Utilitarism approach and common good approach

Explanation:

Both utilitarianism and the common good approach focus on the ethical aspects of actions. In the case of the first approach, this emphasizes the consequences of an action by analyzing the benefits or harm related to this. This approach is effective in this ethical dilemma because it is necessary to consider both the benefits for humans that will obtain fresh water and the harm in the natural ecosystem.

On the other hand, the common good approach states any individual good including access to water is linked to the general good. In the ethical dilemma presented this implies the use of water for human society is not ethical except if it leads to a general good, which includes access to water for other species living in natural ecosystems. According to this, these two approaches or theories are the most appropriate for this dilemma.

What impacts does plastic have on the environment and how can we help?

Answers

Answer:

Millions of animals are killed by plastics every year, from birds to fish to other marine organisms. Nearly 700 species, including endangered ones, are known to have been affected by plastics. Nearly every species of seabird eats plastics. Most of the deaths to animals are caused by entanglement or starvation.

Explanation:

Answer:

Plastic pollutes our oceans and destroys animals habits. This is a massive problem as sea animals eat plastic thinking its food, they eat it and think they're full up however they are still hungry and die of starvation. To help we can stop using plastic and use paper bags instead of plastic bag.

Which zones are temperate zones

Answers

Answer:

Zones a and c

I'm pretty sure

Zones a and c are temperate zones.

what do they have in common?

Answers

Answer:

d

Explanation:

it’s not d, i’d say it’s (a)- they are all rapid processes because they’re all natural disasters that happen pretty quickly.

Which of these statements best describes tides?
a water level lower than the average water level
a water level higher than the average water level
changes in water level that happen when Earth, the sun, and the moon
form a straight line
O
the periodic rise and fall of water levels in the oceans and other large
bodies of water

Answers

the periodic rise and fall of water levels in the oceans and other large

bodies of water.

One of Peter I's most memorable reforms is the beard tax he enforced in Russia.
Which two details BEST Support the central idea above?
a )Among his reforms, Peter I revised Russia's calendar, Introduced changes to the
way
Russlan was written, and completely changed the military.

b)He also tried to get Russians to go beardless, like the 'modern western Europeans he had
met on his tour.

c)Peter I began the practice of breathlessness in quite a dramatic fashion at a reception held
in his honor not long after he came back from Europe.

Answers

Answer:

i think is b

Explanation:

Lori estimates that the circumference of the circle will be 15 centimeters. Do you agree or disagree?
Explain why.

Answers

Which of the following is true for a circle that has an area of approximately 113 square feet?

a
The diameter is 6 feet and the circumference is 38 square feet.
b
The radius is 6 feet and the circumference is 38 square feet.
c
The diameter is 6 feet and the circumference is 38 feet.
d
The radius is 6 feet and the circumference is 38 feet.

What started the Persian War?

O The Athenians killed the Persian Emperor Xerxes. His grandson Darius wanted revenge against the Athenians.

O Persians raised taxes in lonia and Athens supported a rebellion against the Persians

O The Athenians killed the Persian Emperor Darius. His grandson Xerxes wanted revenge against the Athenians.

O Athens raised taxes in lonia and Persia supported a rebellion against the Athenians

Answers

Answer:

when Greeks in the Persian-controlled territory rose in the Ionian Revolt. Athens, and other Greek cities, sent aid, but were quickly forced to back down after defeat in 494 BCE. Subsequently, the Persians suffered many defeats at the hands of the Greeks, led by the Athenians.

Explanation:

3. A friend asks you about taking a vacation to a relatively warm climate with Mild winters
and Dry summers. Which country would best fit that description?

a. England
b.. Ireland
c. Italy
d. Russia

Answers

Answer:

c

Explanation:

It's C because it has a warm climate and mild winters

Can someone answer one or all, please? The questions are number 4-6, and the evidence is the graph

Answers

Answer:

3)#5

4)#2&#4

5)230

6)50

Which three are formed due to compression?

Answers

Explanation:

Anticline, syncline, and reverse fault are geological structures formed due to compression

Answer:

The correct option is B.

B) Anticline, Syncline and Reverse Fault

Explanation:

edge

What mph should a 11 year old boy be running. Same with a 13 year old boy what should be their average mph

Answers

The average mile time for a 13 year old boy is probably around 7:45–8:25

An 11 year old running a mile in under 8 minutes 50 seconds for boys.

describe the location of india

Answers

Answer:

India is positioned on the Indian subcontinent in south-central Asia, and is located in both the eastern and northern hemispheres. India bordered by the Arabian Sea, Bay of Bengal, Gulf of Mannar, Indian Ocean, and the countries of Pakistan, China, Nepal, Bhutan, Bangladesh and Burma (Myanmar).LATITUDE & LONGITUDE:

Latitude/Longitude (Absolute Locations) New Delhi: (capital city) 28° 38' N, 77° 13' E Kochi: 9° 55' N, 76° 16' E Kolkata: 22° 34' N, 88° 21' E Mumbai: 19° 4' N, 72° 52' E Srinagar: 34° 5' N, 74° 47' E.

Explanation:

.

Location of India

India lies entirely in the Northern Hemisphere and Eastern Hemisphere.The main land extends between latitudes 8°4' N and 37°6' N and longitudes 68°7 'E and 97°25 'E.The country is divided into almost two equal parts by the Tropic of Cancer (23° 30' N).

Hope you could get an idea from here.

Doubt clarification - use comment section.

how many atoms are in 2.5 moles of carbon.

Answers

Answer:

4.52*10^23 atoms in 2.5 moles of carbon.

Explanation:

multiply 2.50 mol CO2 by 3 atoms/1 mol CO2 before multiplying by 6.022*10^23 atoms/1mol atoms.

In 2.5 moles of Carbon (C) there are 12.53‬^23 atoms. This is arrived at by utilizing Avogadro's number.

What is a mole?

Mole is short for molecules. Molecules are a combination of atoms.

What is the calculation for the solution above?

To derive the number of atoms in 2.5 molecules of carbon, we need to divide it's weight in grams with the atom mass units.

To get the atomic mass units (amu) we need to check the periodic table.

Once the division is done, the result must be multiplied by Avogadro's number which is stated as 6.02 x 10^23.

Thus, the formula is given as:

amu = grams/mole; or

u = g/mole

Since the Molar Mass of Carbon is 12.01g/mol

The number of atoms will be


2.5/12.01 X  6.02 x 10^23.

= 0.20815986677768526228143213988343‬ x 6.02 x 10^23.

=  1.2531223980016652789342214820983‬ x 10^23.

= 12.531223980016652789342214820983‬^23.

≈ 12.53‬^23.

It is to be noted that the molar mass of carbon is derived from the Periodic Table.

Learn more about mole at:
https://brainly.com/question/15356425
#SPJ6

Questions in this section: Mark the best answer to questions on the geologic history and contact relationships of the Hutton Gulch area. Multiple Choice 1. The contact between the granite and the gneiss represents what type of contact? a. intrusive contact. b. fault (tectonic) contact. c. nonconformity. 2. Which rock unit is the oldest in this cross-section? a. Diorite c. Granite b. Basalt d. Gneiss d. angular unconformity. e. disconformity. e. Breccia 3. What principle allows you to best distinguish the age relationship between the gneiss and the diorite? a. law of superposition d. cross-cutting relationship b. law of original continuity e. principle of inclusion c. law of original horizontality 4. The granite cuts across the gneiss, what other principle allows you to distinguish the age relationship between the gneiss and the granite? a. law of superposition d. principle of inclusion b. law of original continuity e. faunal succession c. law of original horizontality

Answers

Answer:

Metamorphic rocks (from the Greek meta, change, and morphe, form, "change of shape") result from the transformation of pre-existing rocks that have undergone structural and mineralogical adjustments under certain physical or chemical conditions, or a combination of both, such as the temperature, pressure and / or chemical activity of the fluids agents of metamorphism These adjustments, imposed exclusively under the surface, transform the original rock without losing its solid state, generating a metamorphic rock. The rock generated depends on the composition and texture of the original rock, the agents of metamorphism, as well as the time in which the original rock was subjected to the effects of the so-called metamorphic process. Due to the nature of their origin, there may be a complete gradation between metamorphic rocks and the igneous or sedimentary rocks from which they were formed. The study of these rocks provides very valuable information about the geological events that occurred within the Earth and about their variation through time.

Explanation:

To classify a metamorphic rock, the type of metamorphism involved must be known, which can be variable since it depends on the criteria that are taken as a basis to differentiate it: it can be classified from the point of view of extension, fit and cause , geological value, increase or decrease in temperature, etc., but it is very common to define three main types of metamorphism according to the predominant metamorphic agent: Regional, Contact and Dynamic.

hope my answer helped you

Which one do you think is better able to connect with other realms of the world, Russia or Europe?

Answers

Europe it’s a continent with many countries different governments and most of them are socialist, and Russia is just a country with one government and a communist one. But what’s your real question?

Help me please okay thanks if you help me

Answers

Answer:

pull of the moons gravity

Explanation:

Which of two Earth's spheres are involved when a volcano is erupting?
atmosphere and hydrosphere
geosphere and cyrosphere
geosphere and atmosphere
O geosphere and biosphere
I will give brainleast

Answers

Answer:

Geosphere and Biosphere

Explanation:

The geosphere is the Earth itself, while the biosphere is all life within the atmosphere.

What the other guy/ girl said

24. Despite great European access to the sea, Switzerland and Austria are European countries that are “landlocked”.
a. correct
b. incorrect

Answers

Answer:

A.correct

Explanation:

Landlocked means that a country does not border a ocean or sea.

A. correct
the countries do not share borders with an ocean

If an S wave were to go from a solid to a liquid - what would happen to its velocity?

Answers

If the S wave travels after traveling through the solid object then its speed tend to slow down after it reaches the liquid objects. As the S wave is a secondary wave and is known to have to take a different path when it reaches the liquid region.

Hence the S waves don't flow easily through this layer. Thus they are unable to travel through.

Learn more about the from a solid to a liquid - what would.

brainly.com/question/217038.

20. The study of plate movement is called
5 points
North
Lande Foca
Cab
Arabia
plate
Cocos
plate
Pack
NA
A
plate
pate
South American
Scoala
Cat University of Wa Al Rio
o continental drift
The study of plate movement is called?

Answers

The study of the movement of lithospheric plates comprising the earth's crust is called plate tectonics.

i have a 6 in the tens place and 7 in the ones place.i am greater than 200 but less than 400.what number i am?​

Answers

Answer: 267 and 367

Explanation:

The numbers that have a 6 in their tens place and a 7 in their ones place which are also greater than 200 but less than 400 are 267 and 367.

For 267, we can see that we have 6 in the tens place and 7 in the ones place. Likewise, for 367, we can see that we have 6 in the tens place and 7 in the ones place as well.

How is the Human Development Index (HDI) determined? O A. Knowledge, standard of living, and life expectancy O B. Reading and literacy rates, birthrates, and immigration levels O C. Reading and literacy rates, health care facilities, and gross domestic product O D. Knowledge, life expectancy, and health care facilities​

Answers

The correct answer is C. Reading and literacy rates, health care facilities, and gross domestic product.

Explanation

The Human Development Index is a measure that summarizes human development in a given country from three basic aspects that are:

Life expectancy, which is summarized as having a long and healthy life from the moment you are born; The level of literacy, is the knowledge that is measured from the adult literacy rate and the combination of the gross enrollment rates of primary, secondary and tertiary; the last indicator is the country's GDP per capita. Therefore, the correct answer is C. Reading and literacy rates, health care facilities, and gross domestic product

Scientists use instruments to observe and measure each element of weather. A/an __________ is used to measure wind speed.

A. Wind vane


B. Barometer

C. Anemometer

D. Thermometer

Answers

Answer:

A

Explanation:

not sure with my answer

Which of these climate types could be located highest in latitude, in either hemisphere?

Answers

Answer:

Explanation: Taiga and Tundra are highest in latitude due to having the least amount of sunlight.

what is masswasting. ?.

Answers

Answer:

Mass wasting, also known as slope movement or mass movement, is the geomorphic process by which soil, sand, regolith, and rock move downslope typically as a solid, continuous or discontinuous mass, largely under the force of gravity, frequently with characteristics of a flow as in debris flows and mudflows

Explanation:

Thats what wikipedia said

Discribe three new technologies or products that you can use if you want to conserve energy.

Answers

Answer:

Hybird and electric cars, uses fewer fossil fuel resources, and create less pollution. CFL light bulbs last 10 times longer than traditional bulbs, and uses less energy. Energy-efficient appliances like washing machines that reqiure less water and use less power.

Explanation:

Which country listed has the highest human development ranking?

Answers

Answer:

Norway

Explanation:

Norways is ranked No.1

Other Questions
what's the fourth proportional of 0.2, 0.5, 6 transcribe this strand of DNA 5' 3 TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid- What is the best name for polynomial with 3 terms that has a degree PLEASE HELP ITS DONE IN 16 HOURSSS!!!question: A substance with 12 negatively charged atoms combined with a substance that has 10 positively charge atoms. What is the total charge of the substance when the atoms are combined?answer options: +22-22+2-2 6. What were the first Native American civilizations, and where were they located? Estoy tan aburrida as que aqu hay algunos puntos gratis. What percentage of Americans use solar power ? Copy the shape and fill in the missing angle. Sow the work. Thanks. hey can someone give me an idea how I should do a rough draft on a computer What is the range of the function y=-2/3x-10given a domain of{-9,-3,0,3,9} Read this sentence from paragraph 2 of "Puzzle Solved"Solving this thing is as easy asslaying Medusa!Why does Anya compare the cryptogram to slaying Medusa?A It is difficult to conquerOB. It is based on mythologyoc. It is not what it seems.OD. It is hard to look at. A 55 kg boy is riding a skateboard at a speed of 1.0 m/s. What is hiskinetic energy? A right rectangular prism has a length of 6 centimeters, a width of 7 centimeters, and a height of 5 centimeters. What is the volume of the prism? ____cm3a) 214b) 197c) 210CORRECT ANSWER= BRAINLY!! 60>x and x >57A x=61B x=59C x=50 In a transverse wave, the distance from any two consecutive crest or any two consecutive troughs is called the How will the motion of an object be affected if equal forces are applied in opposite directions? Pls, answer asap!When two objects of different temperatures are placed in contact with one another, eventually: (choose one option from below)a) both their average kinetic energy and temperature will be the sameb) their average kinetic energy will be the samec) neither their average kinetic energy and temperature will be the samed) their temperature will be the same 1 NEED HELP ASAP WILL GIVE BRAINLY Help please please help me Line r is parallel to line c.